Public Pricelist
Sort By: Featured
  • Vaccine research
  • Beads
  • Elisa Assay Kit
  • Dyes
  • Strains
  • Molecular Biology
  • Monoclonal Antibodies
  • Cell lines and Normal Cells
  • Serum for Cell Culture and IgG
  • Lentivectors
  • Caspases
  • FFPE Formalin-Fixed Paraffin-Embedded
  • Goat Polyclonal
  • Mouse Monoclonal
  • Rabbit Polyclonals
  • Exosomes
  • E. coli Recombinant
  • E. coli Recombinant
  • Horseradish peroxidase (HRP)
  • Tumor
  • Plasmids
  • Assay test kits
  • NATtrol Controls
  • RNA research
  • Particles
  • Peptide
  • Tauns
  • biolipidure
Goat Anti-MDA (MD20A-G1A) 1mG.
973.00 € 973.0 EUR
Goat Anti-Human IgG (H&L) - 500mL
1,105.00 € 1105.0 EUR
Goat Anti-Human Factor H - 1ml/vial
426.00 € 426.0 EUR
Goat Anti-Guinea Pig IgG (H&L) - 500 mL
1,105.00 € 1105.0 EUR
Goat Anti-Brucella antibody - 100 ul (1mG./ml)
483.00 € 483.0 EUR
Goat Anti-Bird IgG (H+L)-HRP conjug.ate - 0.5ml
440.00 € 440.0 EUR
Goat Anti Rabbit IgG HRP (H+L), Goat polyclonal antibody specific for rabbit IgG (H+L), purified by affinity chromatography, conjug.ated to Horseradish Peroxidase 1.0 mG./mL
660.50 € 660.5 EUR
Glypican 3 Monoclonal Antibody [clone 1G12] - 25ug.
663.00 € 663.0 EUR
Glypican 3 - 250ug.
3,579.00 € 3579.0 EUR
Glyphosate ELISA Plate and Derivatization Test- 96 Tests
1,458.82 € 1458.82 EUR
Glycosaminoglycans Assay Test
558.00 € 558.0 EUR
Glycogen Assay Test (Fluorometric) - 100 assays
690.00 € 690.0 EUR
Glycogen Assay Test (Colorimetric) - 100 assays
690.00 € 690.0 EUR
Glycinin ELISA Test, 96-well plate
1,200.00 € 1200.0 EUR
Glycine max Lectin (SBA) - FITC (Fluorescein), 2mG.
308.80 € 308.8 EUR
Glycerol monomethacrylate - 25 g
283.40 € 283.40000000000003 EUR
Glycerol 50%, Sterile. 250ml
240.57 € 240.57 EUR
Glycerol 50%, Sterile solution 100ml
114.00 € 114.0 EUR
Glycergel - 15 mL
176.00 € 176.0 EUR
Glutathione Reductase Assay Test (100 tests)
378.80 € 378.8 EUR
Glutathione Coated Polystyrene Particle (0.5% w/v 4.0-4.9 µm) - 5 mL
313.00 € 313.0 EUR
Glutathione (GSH) ELISA Test - 96 tests
665.01 € 665.01 EUR
Glucose-6-Phosphate Dehydrogenase (G6PDH) Activity Assay Test - 100 assays
726.00 € 726.0 EUR
Glucagon Antibody - 100 µL
388.75 € 388.75 EUR
Global DNA Methylation ELISA Test (5’-methyl-2’-deoxycytidine Quantitation) - 96 assays
895.00 € 895.0 EUR
GloMelt Thermal Shift Protein Stability Test with Rox
830.00 € 830.0 EUR
GloMelt Thermal Shift Protein Stability Test - 200 assays, No ROX
400.00 € 400.0 EUR
GloMax® 20/20 Luminometer
10,397.00 € 10397.0 EUR
Gliadorphin-7 - 5mG.
430.00 € 430.0 EUR
Gliadin (GAF-3X) IgG ELISA - 96T
850.00 € 850.0 EUR
Gliadin (GAF-3X) IgA ELISA - 96T
850.00 € 850.0 EUR
Glass Micropipettes - Pre-Pulled Microcapillaries for Microfluidic Applications - 30µm internal diameter (4.5 cm length) - 30 pack
819.00 € 819.0 EUR
Glass Micropipettes - Pre-Pulled Microcapillaries for Microfluidic Applications - 20µm internal diameter (4.5 cm length) - 30 pack
819.00 € 819.0 EUR
Glass Micropipettes - Pre-Pulled Microcapillaries for Microfluidic Applications - (Pre-pulled Micropipettes; Part No. mG.M-1 x)10µm internal diameter (4.5 cm length) - 30 pack
819.00 € 819.0 EUR
Glass Cover Slides - 18 mm Circular Glass Cover Slides - Siliconized
335.00 € 335.0 EUR
Glass Beads 1.0mm - Glass beads. 1.0mm. 1 lb. Non-sterile.
155.00 € 155.0 EUR
Glass Beads 0.5mm - Glass beads. 0.5mm. 1 lb. Non-sterile
155.00 € 155.0 EUR
Gifu Anaerobic Broth (GAM), 500 g
87.00 € 87.0 EUR
Gibco Bacto Yeast Extract
460.00 € 460.0 EUR
Gibco Bacto Proteose Peptone
560.00 € 560.0 EUR
Giardia lamblia-S. cerevisiae E. coli Rec., titered - 1 mL,
790.00 € 790.0 EUR
Giardia intestinalis, 150 test
1,015.00 € 1015.0 EUR
Giant Knotweed Extract (Standard) 98% Resveratrol - 75 g
480.00 € 480.0 EUR
Giant Knotweed Extract (Standard) 50% Resveratrol - 75 g
428.00 € 428.0 EUR
Ghrelin Human (Total) - RIA Test - 125 Tubes
1,300.00 € 1300.0 EUR
Geotrichum candidum PCR - 96 Reactions
768.00 € 768.0 EUR
Geotrichum candidum One-Step real time PCR Test - 50 rnx
634.00 € 634.0 EUR
Gentodenz (Density gradient medium for cell separation) - 500 grams
320.00 € 320.0 EUR
Gentodenz (Density gradient medium for cell separation) - 250 grams
230.00 € 230.0 EUR
Gentodenz (Density gradient medium for cell separation) - 100 grams
150.00 € 150.0 EUR
Gentamicin Sulfate USP, 25G
475.00 € 475.0 EUR
Gentamicin Solution (50mG./ml) 10ml
85.00 € 85.0 EUR
Gentamicin C2 sulfate, EvoPure® - 10 mG.
826.00 € 826.0 EUR
Gentamicin C1a sulfate, EvoPure® - 10 mG.
826.00 € 826.0 EUR
Gentamicin C1 Sulfate, EvoPure® - 10 mG.
826.00 € 826.0 EUR
Gentamicin - 10 mL
184.00 € 184.0 EUR
Genomic DNA Isolation Test-50 assays
569.00 € 569.0 EUR
Genomic DNA - Mouse Normal Tissue: Brain 100 ug.
500.20 € 500.2 EUR
Genipin - 5G
370.00 € 370.0 EUR
Genesig Std Real-time PCR detection Test, Tilapia lake virus 150 tests
874.00 € 874.0 EUR
General Vitellogenin, VG ELISA Test 96 wells
500.00 € 500.0 EUR
General Testosterone ELISA Test, 96 test
449.00 € 449.0 EUR
General Sphingosine-1-Phosphate (S1P) ELISA Test - 96 wells plate
925.00 € 925.0 EUR
General Sphingosine (SPH) ELISA Test - 96-wells plate
613.00 € 613.0 EUR
General Selenium Assay Test - 100 Assays
900.00 € 900.0 EUR
General Phosphoenolpyruvate Carboxylase Assay Test 100 Assays
701.30 € 701.3000000000001 EUR
General PTD(Pentosidine) ELISA Test - 96T
480.00 € 480.0 EUR
General Na+/K+ ATPase Assay Test - 100
564.00 € 564.0 EUR
General Melatonin (MT) ELISA Test - 48T
731.00 € 731.0 EUR
General Hydroxyproline (HYP) ELISA Test - 96 wells plate
564.00 € 564.0 EUR
General GFP (Green Fluorescent Protein) ELISA Test - 96 wells plate
582.00 € 582.0 EUR
General Estradiol, E2 ELISA Test, 96 test
479.00 € 479.0 EUR
General Docosahexaenoic Acid (DHA) ELISA Test - 96 wells plate
794.00 € 794.0 EUR
General Docosahexaenoic Acid (DHA) ELISA Test - 48 wells plate
641.00 € 641.0 EUR
General Cortisol (COR) ELISA Test - 96 wells plate
450.00 € 450.0 EUR
General Chondroitin sulfate,CS elisa Test - 96T
638.00 € 638.0 EUR
General Chitinase Assay Test - 100 Assays
722.00 € 722.0 EUR
General CML/ N(6)-Carboxymethyllysine ELISA Test, 96 tests
558.00 € 558.0 EUR
General 5-Hydroxyindoleacetic Acid (5-HIAA) ELISA Test - 48 Tests
655.00 € 655.0 EUR
GeneQ thermal cycler, 24x0.2ml
2,527.00 € 2527.0 EUR
GeneMATRIX Gram Plus & Yeast Genomic DNA Purification Test - 25 Preps
140.00 € 140.0 EUR
GeneMATRIX Gram Plus & Yeast Genomic DNA Purification Test - 100 Preps
375.00 € 375.0 EUR
Gene Synthesis - Per bp - 5'UTR sequence from Custom gene: 5'-CTATCACCTAAGTGTGGGCTAATGTAACAAAGAGGGATT TCACCTACATCCATTCAGTCAGTCTTTGGGGGTTTAAAGA AATTCCAAAGAGTCATCAGAAGAGGAAAAATGAAGGTAATGTTTTTTCAGACAGGTAAAGTCTTTGAAAATATGTGTAATAT GTAAAACATTTTGACACCCCCATAATATTTTTCCAGAATTAA CAGTATAAATTGCATCTCTTGTTCAAGAGTTCCCTATCACT CTCTTTAATCACTACTCACAGTAACCTCAACTCCTGCCAC A -3' 285bp + 60 bp cloning sites = 345bp Not a deliverable. Use for C452.
300.00 € 300.0 EUR
GenJet In Vitro siRNA Transfection Reagent (Ver. II) - 1 mL
331.00 € 331.0 EUR
Gemcitabine, Free Base, >99%, 500 mG.
284.00 € 284.0 EUR
Gem21 NeuroPlex Supplement without Vitamin A, 10 ml
359.00 € 359.0 EUR
Gellan Gum - 100 g
36.99 € 36.99 EUR
Gellan Gum - 1 kg
114.99 € 114.99000000000001 EUR
Gelatin-Coated Microscope Slides (75X50 mm) - 100 slides/box
652.00 € 652.0 EUR
Gelatin-Coated Microscope Slides (75X25 Mm) - 100 slides/box
552.00 € 552.0 EUR
Gelatin from porcine skin, gel strength 300, Type A - 100 g
120.00 € 120.0 EUR
GelRed® Prestain Plus 6X DNA Loading Dye - 1 mL
146.28 € 146.28 EUR
GelRed® Nucleic Acid Gel Stain trail size - 0.1 ml
164.00 € 164.0 EUR
GelRed Nucleic Acid Stain 10,000X in water - 0.5 ml
300.00 € 300.0 EUR
GelRed Nucleic Acid Gel Stain, 10,000 x in water, 10 ml
2,772.00 € 2772.0 EUR
GelNest Matrix, low growth factor, without Phenol Red
1.00 € 1.0 EUR
GelGreen® Nucleic Acid Stain, 10,000X in water - 0.1 ML
222.40 € 222.4 EUR
GelGreen® Nucleic Acid Gel Stain, 10000X in water, 0.5 ml
277.00 € 277.0 EUR
GelGreen® Nucleic Acid Gel Stain - 10 mL, 10,000X in water
2,640.00 € 2640.0 EUR
GelGreen® Nucleic Acid Gel Stain - 10 mL, 10,000X in water
2,400.00 € 2400.0 EUR
GelGreen Nucleic Acid Gel Stain, 10,000X in DMSO - 0.5ML
275.00 € 275.0 EUR
Gel-Bright Laser Diode Gel Illuminator
2,480.00 € 2480.0 EUR
Gel Drying Film
222.50 € 222.5 EUR
Gamma-ECS | Gamma glutamylcysteine synthase
710.00 € 710.0 EUR
Gamma-Aminobutyric Acid (gABA) ELISA Test - 96 tests
1,050.00 € 1050.0 EUR
Galanthus nivalis Lectin (GNL/GNA) Separopore® 4B - 50 mL
4,263.00 € 4263.0 EUR
GZMK E. coli Rec. protein :: Granzyme K E. coli Rec. Protein, 0.1 mG.
655.00 € 655.0 EUR
GW2580, Free Base, >99% - 10g
2,703.37 € 2703.37 EUR
GVB++ (with Ca and mG.) - 1L
636.00 € 636.0 EUR
GV3101 Electrocompetent Agrobacterium - 6x50µl
691.00 € 691.0 EUR
GV3101 ElectroCompetent Agrobacterium - 6x 50 µl
726.00 € 726.0 EUR
GV3101 Chemically Competent Cell - 10 tubes (100μL/tube)
916.00 € 916.0 EUR
GV3101 Chemically Competent Agrobacterium - 6x50ul
577.00 € 577.0 EUR
GV3101 Chemically Competent Agrobacterium - 18x50ul
980.00 € 980.0 EUR
GV3101 Chemically Competent Agrobacterium - 10x50ul
746.00 € 746.0 EUR
GV3101 AGROBACTERIUM STRAIN
530.00 € 530.0 EUR
GV3101 (pSoup-p19) ElectroCompetent Agrobacterium - 6x50µl
779.00 € 779.0 EUR
GV3101 (pSoup-p19) ElectroCompetent Agrobacterium
694.00 € 694.0 EUR
GV3101 (pSoup-p19) Chemically Competent Cells - 10 tubes (100μL/tube)
916.00 € 916.0 EUR
GV3101 (pSoup) ElectroCompetent Agrobacterium - 6x50ul
779.00 € 779.0 EUR
GV3101 (pSoup) Chemically Competent Cells - 10 tubes (100μL/tube)
995.00 € 995.0 EUR
GV2260 Agrobacterium tumefaciens Strains - 100ul
470.00 € 470.0 EUR
GV2260 Agrobacterium Strain - 100 ul
474.50 € 474.5 EUR
GUINEA PIG, WHOLE BLOOD, ALSEVERS, DONOR, GENDER UNSPECIFIED, 100 ML
1,276.00 € 1276.0 EUR
GT elisa Test :: Rat Glutathione ELISA Test-96-Strip-Wells
1,035.00 € 1035.0 EUR
GSTp active protein :: Glutathione S Transferase Pi (GSTp) Active Protein - 0.1 mG.
890.00 € 890.0 EUR
GSTm1 E. coli Rec. protein :: Glutathione S Transferase Mu 1 (GSTm1) E. coli Rec. Protein - 0.1 mG.
737.00 € 737.0 EUR
GSTA1 active protein - 0.1 mG.
627.00 € 627.0 EUR
GST assay Test :: Glutathione S-Transferase (GST) Assay Test - 96 tests
386.00 € 386.0 EUR
GSSG elisa Test :: Rat Oxidized Glutathione ELISA Test-96-Strip-Wells
1,035.00 € 1035.0 EUR
GSH elisa Test :: Rat Reduced glutathione ELISA Test-96-Strip-Wells
1,035.00 € 1035.0 EUR
GSDMD antibody - 200 ul
593.00 € 593.0 EUR
GS115 Yeast strain (Genotype: His4 , Mut+) - 100ul
361.00 € 361.0 EUR
GRM7003-25G Fast Blue B Salt
113.00 € 113.0 EUR
GPX4 elisa Test :: Human Glutathione Peroxidase 4 (GPX4) ELISA Test - 96-Strip-Wells
1,180.00 € 1180.0 EUR
GPX4 elisa Test :: Human Glutathione Peroxidase 4 (GPX4) ELISA Test - 48-Strip-Wells
950.00 € 950.0 EUR
GPR84 Antibody - 100 ul
452.00 € 452.0 EUR
GPR173 elisa Test :: Bovine G protein-coupled receptor 173 ELISA Test - 96-Strip-Wells
1,140.00 € 1140.0 EUR
GPC3 E. coli Rec. Monoclonal Antibody - 100ul
520.00 € 520.0 EUR
GP2059 Forskolin 10mG.
283.00 € 283.0 EUR
GOT1 active protein :: Aspartate Aminotransferase Active Protein - 25K Units
516.50 € 516.5 EUR
GOLGA6A Antibody 100ul
490.00 € 490.0 EUR
GNMT E. coli Rec. protein - 0.1mG.
360.00 € 360.0 EUR
GN Broth, Hajna - 100 Gms
412.00 € 412.0 EUR
GN Broth Medium 11, 500G
105.00 € 105.0 EUR
GMP E. coli Rec. Human Interleukin-4 (IL-4), 50 ug.
483.00 € 483.0 EUR
GMOScreen RT IPC CsVMV / CV127 / DP305423-1 Soy (LR) for ABI 7500 (Fast) - 96 rxn
1,359.00 € 1359.0 EUR
GMOScreen RT IPC (LR) 35S/NOS/FMV for ABI 7500 (Fast) 96 RT-PCR reactions, up to 44 samples per plate. Multiplex screeningof pFMV, p35s and tNOS in a single tube with internal positive control(IPC).
929.00 € 929.0 EUR
GMOScreen RT 35S/NOS/ABII IPC (LR) - 96 rxn
1,466.00 € 1466.0 EUR
GMOQuant IPC (LR) 35S Screen Corn - 2 x 48 rxns
1,201.00 € 1201.0 EUR
GMOQuant (LR) 35S Screen Soy - 2 x 48 rxns
1,201.00 € 1201.0 EUR
GLP1R-22H E. coli Rec. Human GLP1R Protein, Biotinylated-50ug.-100ug.
2,750.00 € 2750.0 EUR
GLP1R-22H E. coli Rec. Human GLP1R Protein, Biotinylated-50ug.
1,620.00 € 1620.0 EUR
GLP1R E. coli Rec. antibody 0.1mG.
564.40 € 564.4 EUR
GLP1R Antibody - 100ug.
575.00 € 575.0 EUR